• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    Use of (Z) -3-hexenyl esters and method to protect plants against pests. The present invention relates to the use of the acetate, propionate and butyrate esters of (Z) -3-hexenyl, or of a composition comprising said compounds, to protect plants, particularly agricultural crops, against pests, by stimulating of the defense mechanisms that the plants themselves have. The invention also relates to a method of protecting plants against pests by bringing the aforementioned esters into contact with the plants. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2763224A1
    申请号:ES202030330
    申请日:2020-04-21
    公开日:2020-05-27
    发明作者:Hedo Meritxel Perez；Garcia Alberto Urbaneja；Valiente Miquel Alonso；Llopis Vicente Navarro；Gonzalez Sandra Vacas；Nebot Jose Luis Rambla；Richart Antonio Granell
    申请人:Consejo Superior de Investigaciones Cientificas CSIC；Universidad Politecnica de Valencia；Instituto Valenciano de Investigaciones Agrarias IVIA；
    IPC主号:
    专利说明:

    [0002] Use of (Z) -3-hexenyl esters and method to protect plants against pests
    [0004] The present invention relates to the use of the esters (acetate, propanoate or butanoate) of (Z) -3-hexenyl, or of a composition comprising said compounds, to protect plants, particularly agricultural crops, against pests, by the stimulation of the defense mechanisms that the plants themselves have. The invention also relates to a method of protecting plants against pests by applying the aforementioned esters to plants.
    [0006] Therefore, the present invention falls within the technical field of pest control in plants.
    [0008] BACKGROUND OF THE INVENTION
    [0010] Ensuring food security is one of the most pressing challenges facing the world population today. Global agricultural production faces the challenge of meeting the growing demands for food for a population that, according to the FAO, will reach 9,000 million inhabitants in 2050. This need must be able to be addressed despite the adversities that changes in consumption patterns, the impacts of climate change and the increasing scarcity of water and arable land. In addition, to these adversities we must add the already significant yield losses in the crops caused by the different stresses, both abiotic and biotic.
    [0012] In the particular case of pests, pathogens and weeds, crop losses vary with each specific crop, but in general, it is admitted that pests and diseases participate in a similar way, with 15% each group, while bad herbs do it with another 13%. These amounts should be added between 9 and 20% of additional losses in post-harvest.
    [0014] Unfortunately these figures will increase in the coming years as a consequence of the new conditions derived from climate change, such as the introduction of new pests or exotic diseases in our agriculture. As an example, in In the Valencian Community, the number of exotic agricultural pests introduced during the last 20 years reaches almost one per year. Sometimes they are introductions that can go unnoticed, but unfortunately some of them break into our crops with force as they are not accompanied by their natural enemies, quickly becoming key pests. A case known for the media repercussion that it supposed, and that can serve as a paradigmatic example of an exotic pest in said Community, is the tomato moth, Tuta absolu (Meyrick) (Lepidoptera: Gelichiidae), which was detected at the end of 2006 in the Castellón province and which quickly became a key pest of this crop worldwide.
    [0016] From the birth of agriculture as such some 10,000 years ago to just 65 years ago, agriculture was a holistic activity, based on a systemic approach. Agricultural societies designed crop protection programs based primarily on pest prevention. This true form of agroecological management included, among others, crop rotation, planning of different crop combinations, use of resistant or tolerant cultivars, choice of correct planting and harvesting periods, biological, mechanical and physical control, etc.
    [0018] However, as plant genetics, synthetic fertilizers, and pesticides developed, agricultural research shifted from a holistic approach to an extremely reductionist science where pests were primarily combated on the basis of calendar of treatments or curative treatments. The increasing use of synthetic pesticides led to a serious loss of biodiversity, and this in turn to a reduction in the functioning of ecological infrastructures that allow pest regulation, pollination and water purification. In addition, it has also involved an exorbitant contribution of resources and financial consequences of billions of euros.
    [0020] At this point, in recent years and from various governments and organizations around the world, there has been an appeal to return to a approach of crop protection closer to ecology. Throughout the European Union, a framework for community action has been established to achieve a sustainable use of pesticides (Directive 2009/128 / EC), which has made it mandatory for all fruit and vegetable production produced in the European Union to be under the precepts of Integrated Pest Management (GIP) (or, where appropriate, organic farming).
    [0021] Despite all these efforts, currently both in GIP and organic farming, unfortunately in most cases pest control still resides in curative treatments with pesticides, since in both types of agriculture there are products authorized to it. In the context in which this invention is presented, it is understood that, regardless of the type of pest management that is being used (GIP or ecological), the first line of crop protection should be the implementation of preventive control methods such as cultural methods, the use of resistant / tolerant plants, the application of strict quarantine regulations, and the promotion of natural pest control. It is in this previous context that the use of the present invention would be framed. When, despite these efforts, pests exceed or are expected to exceed acceptable population levels (economic damage threshold), biological pest control should be the first option to be used, if necessary in combination with other control tactics. GIP (where pesticides would be last).
    [0023] This concept, which has recently been coined as "conscious agriculture", would respect the environment and the availability of resources for future generations.
    [0025] In recent years, the use of omnivorous natural enemies in horticultural crops, and in particular zoophytophage predators that can feed on both the plant and prey, has led to some of the most resounding successes in biological control in our country. Thus, for example, in pepper the release and conservation of the predatory mite Amblyseius swirskii (Athias-Henriot) (Acari: Phytoseiidae) together with the anthochorid Orius laevigatus (Fieber) (Hemiptera: Anthocoridae) allows to successfully manage the populations of key pests of this crop: the whitefly Bemisia tabaci Gennadius and the thrips Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae). Similarly in tomato, the cosmopolitan myrid Nesidiocoris tenuis (Reuter) (Hemiptera: Miridae) allows effective control of B. tabaci and the tomato moth T. absolu .
    [0027] Recently, it has been shown how some of these zoophytophage predators, due to their phytophagia, activate the same defense mechanisms that cause obligate herbivorous arthropods. It is widely known that plants respond Phytophagous attacks (induced defenses) through various response pathways.
    [0029] These defenses can, among other phenomena, provoke the production of secondary metabolites and proteins that have toxic, repellent and / or anti-food effects on herbivores (direct defenses). Also trigger the production and release of volatiles ( Herbivore-induced plant volatiles : HIPVs, from the English Herbivore-induced plant volatiles) by the plant that can modify the behavior of both phytophagous pests and their natural enemies (defenses hints). Previous works cited below have shown that several species of zoophytophage predators that have been used in biological pest control strategies are capable of inducing defenses in various horticultural crops such as peppers and tomatoes. These inducible defenses are undoubtedly an added value that these biological control agents possess and if properly managed, they could offer an excellent tool to increase the resilience of crops.
    [0031] In a first stage it was possible to verify how the phytophagy of the predator N. tenuis activated the metabolic pathway of abscisic acid and jasmonic acid (JA) in tomato plants, which made them less attractive to the whitefly B. tabaci, and more attractive for the whitefly parasitoid Encarsia formosa (Gahan) (Hymenoptera: Aphelinidae). Furthermore, it was observed how the volatiles emitted by N. tenuis minced plants could induce defenses in neighboring intact plants by activating the JA pathway, which also resulted in the attraction of parasitoids by these intact plants that had not been exposed to N. you have It was subsequently confirmed that all N. tenuis developmental stages (from young nymphs to adults) are capable of triggering these defensive responses. However, not all zoophytophagous predators have the same ability to induce such responses in tomato plants. Tomato plants can have different degrees of attraction for pests and natural enemies depending on whether phytophagia is produced, for example, by N. tenui s, Macrolophus pygmaeus (Rambur) or Dicyphus maroccanus Wagner (Hemiptera: Miridae). Thus, while plants damaged by N. tenuis reject B. tabaci and T. absolute, the phytophagia of M. pygmaeus and D. maroccanus has no effect on repellency in B. tabaci and attracts T. absolu. On the contrary, the activity of the three mirids results in the attraction of E. formosa .
    [0032] Volatiles (HIPVs) involved in responses have recently been identified defense of tomato plants induced by M. pygmaeus and N. tenuis : six green leaf volatiles (GLVs), methyl salicylate and octyl acetate ((Pérez-Hedo, M. et al. Biocontrol, 63: 203- 213 (2018)) .In general, plants exposed to N. tenuis emitted more volatiles than plants exposed to M. pygmaeus, and the latter emitted more volatiles than intact plants. All six GLVs and methyl salicylate were found to be repellent to B. tabaci and attractive for E. formosa, while they did not show an effect on absolute T. These results clearly show how the herbivory of the mirids can modulate the preference of a pest or a natural enemy depending on the exposure to a certain volatile and opens doors to possible practical applications of such compounds.
    [0034] In pepper it has been verified how also the phytophagy of anthochorid O. laevigatus triggers defensive responses in the plant (Bouagga et al . Journal of Pest Science, 91: 55-64 (2018)). Specifically, pepper plants exposed to O. laevigatus induce repellency against the whitefly B. tabaci and thrips F. occidentalis. In contrast, the whitefly parasitoid E. formosa is attracted to plants exposed to O. laevigatus. Phytophagy of O. laevigatus triggers the release of a mixture of volatiles (5 terpenes, 2 GLVs, methyl salicylate and one to be identified) and the activation of the metabolic pathways of jasmonic acid and salicylic acid. Similarly, the phytophagia of the N. tenuis and M. pygmaeus myrids in bell pepper also caused repellency for B. tabaci and F. occidentalis and attraction for E. formosa and triggered volatiles similar in nature to those triggered by O. laevigatus.
    [0036] Perhaps one of the most interesting results to date has been to verify how greenhouse tests on both tomato and pepper plants that had previously been activated (exposed) for 24 hours by N. tenuis, the red spider infestation, Tetranychus urticae Koch (Acari: Tetranychidae) and B. tabaci was significantly lower compared to pepper plants not exposed to the predator. Since zoophytophagous predators have been used in horticultural crops, a lower incidence of certain virus diseases has been observed. Recently, it has been verified how the defenses induced by predatory mirids decrease the multiplication of phytopathogenic viruses, specifically the pepper tomato tanning virus (TSWV) (Bouagga et al . Pest Management Science, 76: 561-567 (2020)). As previously mentioned, there have been identified volatile compounds that are responsible for the repellency and attraction to pests and natural enemies.
    [0038] In recent years, the number of research projects trying to use these volatiles to induce plant defenses has increased considerably (Turlings, TCJ, Erb, M. Annu. Rev. Entomol. 63, 433-452 (2018)). For example, in maize, exposure to (Z) -3-hexenal, (Z) -3-hexen-1-ol and (Z) -3-hexenyl acetate managed to overexpress the jasmonic acid pathway (Engelberth, J. , HT Alborn, EA Proc. Natl. Acad. Sci. 101, 1781-1785 (2004). However, none of them has been able to obtain results that show a defensive response of plants under real field conditions. the application of (Z) -3-hexenyl propionate by diffusers has elicited a defensive response in commercial crops as presented in this invention.
    [0040] In this invention, it is shown that (Z) -3-hexenyl esters are elicitors of the induction of direct and indirect defenses in crops, such as tomato cultivation. Specifically, plants have been defensively activated simply by exposing them to these synthetic volatiles. Exposure of (Z) -3-hexenyl esters have been described as phytophagous repellents that plague the whitefly, Bemisia tabaci and attractant of natural enemies such as the whitefly parasite, Encarsia formosa (Pérez-Hedo, M. et al. Biocontrol , 63: 203-213 (2018)). The attraction to parasitoids is an indirect effect that can benefit the biological control of a pest.
    [0042] The present invention is a sustainable and biorational pest control tool based on inter-plant communication for crop protection. Plants use the emission of these volatiles to communicate certain aggressions to their "neighbors." Plants that receive these signals enter a state of alert in which they prepare for a future attack. This is known as priming.
    [0044] DESCRIPTION OF THE INVENTION
    [0046] The inventors of the present invention have found that the compounds according to Formula I, where R = CH 3 , CH 2 -CH 3 or CH 2 -CH 2 -CH 3 , are capable of alerting plants exposed to them and inducing mechanisms of defense in them that reduce the impact of pests, in a way that induces or elicits the natural defenses of plants.
    [0050] Formula i
    [0052] By using these volatile compounds, the plant is defensively activated through the hormonal pathways of jasmonic acid and salicylic acid, both phytohormones involved in plant defense mechanisms.
    [0054] The defensive activation that is achieved with these compounds makes activated plants more resistant to attack by pests.
    [0056] Then, in a first aspect, the present invention refers to the use of at least one compound of formula I defined above, or of a composition comprising it, for the protection of plants against pests by stimulating natural defense mechanisms. of these plants.
    [0058] These mechanisms cause plants to repel pests and / or attract parasitoids from such pests. These parasitoids are natural enemies of pests, so, consequently, their attraction makes the plants protected against the aforementioned pests.
    [0060] The compounds used in the present invention are (Z) -3-hexenyl acetate, propanoate or butanoate. In a preferred embodiment, the invention relates to the use of (Z) -3-hexenyl propanoate, or a composition comprising them, for the protection of plants against pests by stimulating the natural defense mechanisms of said plants .
    [0062] In a preferred embodiment, the defense mechanisms of the plants cause the repellency of at least one pest selected from the list comprising: Bemisia tabaci (Gennadius) and Tríaleurodes vaporariorum (Westwood), Aleurothrixus floccosus (Maskell), Dialeurodes citri (Ashmead) and Paraleyrodes minei Iaccarino (Hemiptera: Aleyroididae), thrips Frankliniella occidentalis Pergande the, Pezothrips kellyanus Bagnall, Chaetanaphothrips orchidii (Moulton) and Thrips tabaci Lindeman (Thysanoptera: Thripidae), spider mites Tetranychus urticae, Eutetranychus orientalis (Klein), Eutetranychus banksi (McGregor), T. urticae, Panonychus citri (McGregor) Koch and Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae), the lepidoptera Tuta absolut (Meyrick), Phyllocnistis citrella Stainton (Lepidoptera: Gracillariidae), Spodoptera exigua Hübner and Helicoverpapiren () horticultural crops; and the psyllids Diaphorina citri Kuwayama (Hemiptera: Liviidae) and Trioza erytreae (Del Guercio) (Hemiptera: Psyllidae), in citrus.
    [0064] In an even more preferred embodiment, the pest is selected from the list comprising: the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), the thrips Frankliniella occidentalis Pergande (Thysanoptera: Thripidae), the red spider Tetranychus urticae Koch (Acari : Tetranychidae), the lepidopteran Tuta absolut (Meyrick) (Lepidoptera: Gelechiidae) and the psyllid Diaphorina citri.
    [0066] In a preferred embodiment, the defense mechanisms of the plants cause the attraction of at least one parasitoid selected from the list comprising: species of the genera Encarsia spp., Aphytis spp. Cales spp., Eretmocerus spp., Aphelinus spp., (Hymenoptera: Aphelinidae), Aphidius spp. Lysiphlebus spp. (Hymenoptera: Braconidae) Metaphycus spp., Anagyrus spp. (Hymenoptera: Encyrtidae), Tamarixia spp. Citrostichus spp., Cirrospilus spp., Diglyphus spp. (Hymenoptera: Eulophidae), Trissolcus spp., Telenomus spp. (Hymenoptera: Scelionidae) and Trichogramma spp. (Hymenoptera. Trichogrammatidae).
    [0068] The aforementioned compound has been shown to repel pests of horticultural crops of different orders of Insecta (Hemiptera, Thysanoptera and Lepidoptera), which was not exactly expected as they are very phylogenetically separated species. In the case of citrus fruits, it has been observed how activation with this same volatile decreases the laying of the psyllid Diaphorina citri.
    [0070] In a preferred embodiment the protected plants are horticultural plants or citrus plants. Horticultural plants are preferably selected from the list comprising: tomatoes, peppers, aubergines, onions, leeks, squash, zucchini, cucumbers, chard, lettuce and legumes. More preferably, horticultural plants They are tomato plants ( Solanum lycopersicum) or pepper ( Capsicum annuum). Citrus fruits are preferably selected from the list comprising lemons, limes, oranges, grapefruits and tangerines.
    [0072] In a more particular embodiment, the plant is a tomato plant and the pest is the B. tabaci whitefly , the Frankliniella occidentalis thrips or the Tuta absolute lepidopteran .
    [0074] In another more particular embodiment, the plant is a citrus and the pest is the psyllid Diaphorina citri .
    [0076] In a preferred embodiment, the use comprises the application of the compounds according to Formula I by means of diffusers, which allows said compounds to be used effectively via exposure under field conditions as an inducer / elicitor of plant defenses. This emission system using diffusers achieves that, in the atmosphere surrounding the plants to be protected, a sustained and sufficient concentration of the inductor is obtained, which would not be obtained with a punctual application of the same.
    [0078] According to the present invention, "diffuser" (also called "emitter") is understood to be a device or vehicle (formulation) that distributes at least one of the compounds of the invention (Formula I) at controlled speed via exposure thereof to plants in field conditions. The devices are containers of the compounds according to Formula I that allow these substances to be released into the atmosphere in a controlled way through a membrane, a valve or even through the wall of the container itself. Vehicles are formulations of liquid, gelled or pasty substances that contain the compounds according to Formula I and that are applied in the form of drops or granules so that the volatiles are emitted as the vehicle degrades or dehydrates. These formulations or vehicles can be applied on any part of the plant, on the substrate, on structures in the crop or anywhere from which it can be emitted close to the plants. Within the vehicles are substances such as paraffins, silicones, pectins, heavy oils, polysaccharides, proteins, etc. Among them, the following may be mentioned by way of example: agar-agar, alginine, carrageenan, collagen, corn starch, gelatin, guar gum, carob gum, pectin, xanthan gum, mineral oil, silicone oil, paraffins, olefins or mineral or vegetable oils.
    [0079] Diffusers are preferably devices of two types:
    [0080] (1) passive emitters consisting of a container of the compounds according to Formula I configured to allow the diffusion of said substances, so the container must be permeable to the compounds of formula I, either through its own enclosure of a polymeric material or through a membrane placed in part of its enclosure to regulate the emission;
    [0081] (2) active emitters in which the compounds according to Formula I are packed in a pressure vessel that contains a valve configured to operate on a scheduled basis, as is the case with nebulizers that produce an aerosol.
    [0083] In a more preferred embodiment, the compounds according to Formula I are applied by means of diffusers consisting of low-density polyethylene (LDPE) vials .
    [0085] In a second aspect, the present invention refers to a method for the protection of plants against pests by stimulating the natural defense mechanisms of said plants, said method is characterized in that it comprises contacting at least one compound of Formula I , or a composition that includes it, with plants. Contact can be direct, by direct application of the compound to the plant or indirect, by exposing the plant to an environment that contains the compound.
    [0087] These natural defense mechanisms of plants allow to repel pests or attract natural parasitoids from them.
    [0089] In a preferred embodiment of the method it is characterized in that it comprises the application of (Z) -3-hexenyl propanoate or a composition comprising it.
    [0091] In a preferred embodiment of the method, the pest is selected from the list comprising: Bemisia tabaci (Gennadius) and Tríaleumdes vaporariorum (Westwood), Aleurothrixus floccosus (Maskell), Dialeurodes citri (Ashmead) and Paraleyrodes minei Iaccarino (Hemiptera: Aleyroididae), thrips Frankliniella occidentalis Pergande, Pezothrips kellyanus Bagnall, Chaetanaphothrips orchidii (Moulton) and Thrips tabaci Lindeman (Thysanoptera: Thripidae), red spider mites Tetranychus urticae, Eutetranychus orientalis (Klein), Eutetranychus banksi (McGregor), T. urticae, Panonychus citri (McGregor) Koch and Tetranychus evansi Baker & Pritchard (Acari: Tetranychidae), the Lepidoptera Tuta (Meyrick), Phyllocnistis citrellateratarella , Spodoptera exigua Hübner and Helicoverpa armígera (Hübner) (Lepidoptera: Noctuidae) in horticultural crops; and the psyllids Diaphorina citri Kuwayama (Hemiptera: Liviidae) and Trioza erytreae (Del Guercio) (Hemiptera: Psyllidae), in citrus.
    [0093] In an even more preferred embodiment, the pest is selected from the list comprising: the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), the thrips Frankliniella occidentalis Pergande (Thysanoptera: Thripidae), the red spider Tetranychus urticae Koch (Acari : Tetranychidae), the lepidopteran Tuta absolut (Meyrick) (Lepidoptera: Gelechiidae) and the psyllid Diaphorina citri.
    [0095] In a preferred embodiment of the method, the protection of the plants is produced by the attraction of parasitoids selected from the list that comprises: species of the genera Encarsia spp., Aphytis spp. Cales spp., Eretmocerus spp., Aphelinus spp., (Hymenoptera: Aphelinidae), Aphidius spp. Lysiphlebus spp. (Hymenoptera: Braconidae) Metaphycus spp., Anagyrus spp. (Hymenoptera: Encyrtidae), Tamarixia spp. Citrostichus spp., Cirrospilus spp., Diglyphus spp. (Hymenoptera: Eulophidae), Trissolcus spp., Telenomus spp. (Hymenoptera: Scelionidae) and Trichogramma spp. (Hymenoptera. Trichogrammatidae).
    [0097] In a preferred embodiment of the method, the protected plants are horticultural plants or citrus plants. Horticultural plants are preferably selected from the list comprising: tomatoes, peppers, aubergines, onions, leeks, squash, zucchini, cucumbers, chard, lettuce and legumes. More preferably, the horticultural plants are tomato ( Solanum lycopersicum) or pepper ( Capsicum annuum) plants . Citrus fruits are preferably selected from the list comprising lemons, limes, oranges, grapefruits and tangerines.
    [0099] In a more particular embodiment, the plant is a tomato plant and the pest is the B. tabaci whitefly , the Frankliniella occidentalis thrips or the Tuta absolute lepidopteran .
    [0101] In another more particular embodiment, the plant is a citrus and the pest is the psyllid. Diaphorína citrí.
    [0103] In a preferred embodiment of the method, the compounds according to Formula I, or a composition comprising them, are applied by using diffusers. Diffusers and preferred embodiments thereof according to the present invention have been defined in the first aspect of the invention. In a more preferred embodiment, the compounds according to Formula I are applied by means of diffusers consisting of low-density polyethylene vials.
    [0105] In a preferred embodiment, the application is made at the rate of one diffuser for every 20 m2 of planted area. In this way the diffuser distributes the compound to the environment that surrounds the plants and they detect it.
    [0107] In a preferred embodiment of the method, the compounds according to Formula I are applied to the culture environment in a dose between 25 mg / ha / day and 25 g / ha / day, and more preferably between 200 mg / ha / day and 10 g / ha / day.
    [0109] During the development of this invention, it has been observed, through the use of different diffusers, how the plant is defensively activated when the volatile emission sources do so from 25 mg / ha / day of the compounds according to Formula I. proven that the use of a passive polymeric diffuser is capable of releasing a dose of the volatile depending on the environmental conditions in the range sufficient to activate both tomato, pepper and citrus plants in field conditions.
    [0111] The development of this invention allows for the first time to defensively activate plants such as tomato, pepper and citrus and make them more resilient against pests by exposing the plants to volatiles according to Formula I.
    [0113] The methodology described in the present application by exposure to the compounds according to Formula I activates a previously not described plant response related to overexpression of the salicylic acid and jasmonic acid pathways. This activation causes activated plants to emit volatiles that attract and repel natural enemies and pests, respectively. In the case of tomato, it has been observed that plants exposed to (Z) -3-hexenyl propanoate repel key pests of this crop such as whitefly, B. tabaci, thrips F. occidentalis and al Lepidopteran T. absolute. This activation therefore repels three key pests, which was not to be expected because these three species belong to three different orders of insects (Hemiptera, Thysanoptera and Lepidoptera). In the case of citrus, it has been observed how activation with this same volatile repels the psyllid D. citrí. It has been shown in the case of citrus that the D. citri spawn is also reduced by more than half when the citrus plant has been exposed to this volatile. Plants activated by exposure to (Z) -3-hexenyl propanoate are also more attractive to natural enemies of pests such as the parasitoids Encarsia formosa in tomato and Tamarixia radiata in citrus.
    [0115] In the development of the present invention, it has also been observed how the activation of the plant defensively does not affect the establishment or development of zoophytophage predators that can colonize said culture.
    [0117] Contrary to what would be expected, the overexpression of the defensive routes in the plant caused by the exposure of the volatile propaneate of (Z) -3-hexenyl does not reduce the growth or production of the plant, obtaining as a final result plants just as productive but more resistant to attack by pests.
    [0119] The present invention is a new method of pest management not used to date in any crop.
    [0121] Throughout the description and claims, the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages, and features of the invention will emerge in part from the description and in part from the practice of the invention. The following examples and figures are provided by way of illustration, and are not intended to be limiting of the present invention.
    [0123] BRIEF DESCRIPTION OF THE FIGURES
    [0125] Fig. 1 .: Transcriptional response of the defensive genes PR1 (a marker gene for the salicylic acid signaling pathway, SA) ( Fig. 1A ) and Sl-PI-I and Sl-PI-II (two markers for inhibitors of plant proteinases) ( fig. 1B and 1C respectively) in tomato plants exposed to (Z) -3-hexenyl acetate (HA), (Z) -3-hexenyl butanoate (HB) and (Z) propanoate - 3-hexenyl (HP) and to the control. Data are presented as the mean from eight independent analyzes of transcription expressions in relation to a cleaning gene ± standard error (n = 8). Significant differences based on the ANOVA test are marked with different letters (P <0.05). Response (% ± SE (Standard Error)) of the female Encarsia formosa ( Ef), Tuta absolu ( Ta), Tetranychus urticae ( Tu), Bemisia tabaci ( Bt) and Frankliniella occidentalis ( Fo) in a Y-tube olfactometer when they are exposed to the control (1: 10,000 methanol: water) and (Z) -3-hexenyl propanoate ((Z) -3-HP) (1: 10,000 with the volatile to test). Asterisks indicate significant differences in the distribution of lateral arm choices (X2 tests; P <0.05) ( Fig. 1D ). Number (mean ± standard error) of Tetranychus urticae females per tomato plant when comparing mite development in tomato plants exposed to (Z) -3-hexenyl propanoate [(Z) -3-HP)] compared to unexposed tomato plants (Control). Exposure to (Z) -3-HP was tested in two types of bioassays, (24 h) and (Per): in the first type, the plants were only exposed to the volatile for 24 hours before the release of T. urticae (24 h); In the other type of test, the plants were permanently exposed to the volatile throughout the experiment (Per). Bars with different letters are significantly different (GLMM, repeated measurements at <0.05) ( fig 1E ). Number of eggs (mean ± standard error) laid by 2 Tuta Absolute females for 72 hours in plants exposed to (Z) -3-hexenyl propanoate [(Z) -3-HP)] compared to unexposed tomato plants (Control). Bars with different letters are significantly different (ANOVA, Tukey at <0.05) ( Fig. 1F ). Mortality percentage (mean ± standard error) of absolute T. from egg to adult when it developed in tomato plants exposed to (Z) -3-hexenyl propanoate [(Z) -3-HP)] compared to plants untreated tomato (Control). Bars with different letters are significantly different (ANOVA, Tukey at <0.05) ( Fig. 1G ).
    [0127] Fig. 2 . Transcriptional response of the PIN2 gene (a marker gene for the jasmonic acid (JA) signaling pathway in tomato plants exposed under semi-field conditions to (Z) -3-hexenyl propanoate [(Z) -3-HP] with different Volatile emission levels: 5 mg / day / diffuser in the low-density polyethylene (LD) emitter and 0.01 mg / day / diffuser in the high-density polyethylene (HD) emitter. The control treatment consists of plants not exposed to volatile Significant differences based on the ANOVA test are marked with different letters (P <0.05).
    [0129] Fig. 3 : Transcriptional response of the defensive genes PR1 (a marker gene for the SA signaling pathway) ( Fig. 3A) and PIN2 (a marker gene for the jasmonic acid signaling pathway) ( Fig. 3B ) in plants. tomato exposed in field conditions to (Z) -3-hexenyl [(Z) -3-HP] propanoate released in a 4 ml low density polyethylene vial (Kartell) polymeric dispenser (LD) one day before, 4 and 8 weeks after placing the diffuser. The significant differences between treatments for each of the dates are marked with an asterisk (f-test; P <0.05). Number of Nesidicoris fenuis per plant (mean ± standard error) ( fig. 3C ) and number of infested leaflets per plant (mean ± standard error) ( fig. 3D ) in the commercial greenhouse (GLMM, P <0.05). Adjusted release profile of the fitted dispenser of the linear regression model ( fig. 3E ).
    [0131] Fig. 4 : Transcriptional response of the defensive genes LOX2 (precursor of jasmonic acid JA) ( fig 4A ) and PAL and NPR1, two genes related to the salicylic acid pathway ( fig. 4B and C , respectively) in exposed Carrizo citrange plants to (Z) -3-hexenyl propanoate and to the control. Data are presented as the mean of six independent analyzes of transcription expressions in relation to a cleaning gene ± standard error (n = 6). Significant differences based on the f- test are marked with (*) (P <0.05). Response (% ± SE) of females Diaphorina cifri and Tamarixia radiafa in a Y-tube olfactometer when exposed to control (1: 10,000 methanol: water) and (Z) -3-hexenyl propanoate ((Z) -3 -HP) (1: 10,000 with the volatile to test). Asterisks indicate significant differences in the distribution of lateral arm choices (tests x 2; P <0.05) ( Fig. 4D ).
    [0132] Fig. 5 : Number of receptive shoots (mean ± SE) and lay (mean ± SE) of Diaphorina cifri in the Murraya paniculafa seedlings used as sentinel plants with and without an HP-loaded diffuser. Different letters on the bars show significant differences (f-test P <0.05).
    [0134] EXAMPLES
    [0136] Next, the invention will be illustrated by tests carried out by the inventors.
    [0138] Example 1: Trials of defensive activation in tomato via exposure under laboratory conditions
    [0140] Mephodology
    [0141] To demonstrate that exposure of the volatiles (Z) -3-hexenyl propanoate, (Z) -3-hexenyl acetate and (Z) -3-hexenyl butanoate activates plant defenses, tomato plants Solanum lycopersicum cv. Moneymaker. Two weeks after germination of the seeds, the seedlings were individually transplanted into pots (8 * 8 * 8 cm). The plants were kept at 25 ± 2 ° C, with a constant relative humidity of 65% ± 5% and a photoperiod of 14:10 h (light: dark). Tomato plants that had not received any pesticide treatment at four weeks of age (approximately 20 cm tall) were used. All the volatiles used were obtained through Sigma-Aldrich (St. Louis, MO, USA). Each volatile was exposed by using a 2 x 2 cm portion of filter paper on which 10 pl of a solution containing the volatile corresponding to a concentration of 1: 10,000 [(Z) -3- ester - was impregnated hexenyl: methanol] as the emission source for the corresponding volatile (Pérez-Hedo, M. et al. Biocontrol , 63: 203-213 (2018)).
    [0143] To activate a plant, two portions of filter paper impregnated with the volatile were placed at the bottom of a 30 * 30 * 30 cm plastic cage (BugDorm-1 Insect Tents; MegaView Science Co., Ltd, Taichung, Taiwan) in which the plant was introduced. A control treatment was carried out in which the two portions of filter paper were impregnated with 10 pl of methanol. Eight repetitions per treatment were performed. The plants of the treatments were kept exposed to the volatile without disturbing for 24 hours in separate and isolated climatic chambers to avoid any interference of the volatiles and were kept at 25 ± 2 ° C, 65 ± 10% RH and a photoperiod of 14:10 h (L: D). After 24 hours, the expression of 3 genes related to defensive plant activation in both treatments was studied: the precursor of the protein related to basic pathogenesis (PR-1), a marker gene of the SA signaling pathway, was studied. and two markers of plant proteinase inhibitors (Sl-PI-I and Sl-PI-II).
    [0145] For the extraction and quantification of gene expression, the methodology described by Pérez-Hedo et al. Journal of Pest Science 3: 543-554 (2015). The primers used were direct ( forward): 5'- CTCATATGAGACGTCGAGAAG-3 '(SEQ ID NO: 1) and inverse (reverse): 5'-GGAAACAAGAAGATGCAGTACTTAA -3' (SEQ ID NO: 2) for the quantification of PR1, forward : 5'-TGAAACTCTCATGGCACGAA-3 '(SEQ ID NO: 3) and reverse: 5'- TTTTGACATATTGTGGCTGCTT-3' (SEQ ID NO: 4) for Sl-PI-I, and forward: 5'-GGCCAAATGCTTGCACCTTT-3 '( SEQ ID NO: 5) and reverse: 5'-CAACACGTGGTACATCCGGT-3 '(SEQ ID NO: 6) for the Sl-PI-II gene. The nucleotides of the constitutive EF1 gene were forward: 5'-GATTGGTGGTATTGGAACTGTC-3 '(SEQ ID NO: 7) and reverse : 50-AGCTTCGTGGTGCATCTC-30 (SEQ ID NO: 8).
    [0147] After verifying that exposure to the three volatiles activated genes related to plant defenses, (Z) -3-hexenyl propanoate was selected from the three volatiles as a model for (Z) -3-hexenyl esters.
    [0149] It was studied whether the defensive activation achieved by exposure to propanoate of (Z) -3-hexenyl could have an effect of repellency and / or attraction in herbivores that attack tomato, the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) , the thrips Frankliniella occidentalis Pergande (Thysanoptera: Thripidae), the red spider Tetranychus urticae Koch (Acari: Tetranychidae) and the tomato borer, Tuta absolute (Meyrick) (Lepidoptera: Gelechiidae), and in a natural enemy that has been used As a model organism in this crop, the parasitoid Encarsia formosa Gahan (Hymenoptera: Aphelinidae).
    [0151] The last stage nymphs of B. tabaci and the pupae of E. formosa were provided by Koppert Biological Systems, SL (Águilas, Murcia, Spain). The newly emerged adults of B. tabaci (less than 2 days old) were released into tomato plants inside 60 x 60 x 60 cm plastic cages (BugDorm-2) and placed in a climatic chamber at 25 ± 2 ° C, 65 ± 10% RH and a 14:10 h (L: D) photoperiod in IVIA. Five-day-old adult B. tabaci were used in all experiments. In the case of E. formosa, the pupae were deposited in a 9 cm diameter Petri dish and were allowed to emerge under laboratory ambient conditions (25 ± 2 ° C), with a small drop of honey as food. Females of E. formosa less than two days old were used in all experiments. The adults of F. occidentalis came from a calf kept in captivity established at the Valencian Institute for Agricultural Research (IVIA) in 2010, originally from Campo de Cartagena (Murcia, Spain). The breeding of thrips was kept in bean pods ( Phaseolus vulgaris L .; Fabales: Fabaceae) under the same conditions described above. All F. occidentalis females used for experimentation were less than five days old. The adults of T. urticae were obtained from a colony established in the IVIA in 2011 whose original provenance were Clementines located in La Plana (Castelló, Spain). The mites were kept on tomato plants in a climatic chamber under the same conditions described above. Females of T. absolut were obtained from colonies on tomato kept in a greenhouse of the IVIA at 25 ± 4 ° C, 60 ± 15% RH and low natural photoperiod. Newly emerged adult females less than 5 days old were used in all trials.
    [0153] To assess the preference of F. occidentalis, B. tabaci, T. urticae, T. absolut and E. formosa to tomato plants that were previously exposed for 24 h (Z) -3 -HP in relation to intact plants, we used a Y-shaped olfactometer. The plants were exposed to both volatiles as described above with the use of the filter paper portions. The olfactometer (Analytical Research Systems, Gainesville, FL) consisted of a 2.4 cm diameter Y-shaped glass tube with a 13.5 cm long base and two arms each 5.75 cm long . Both side arms were connected via high-density polyethylene (HDPE) tubes to two identical glass jars (5-liter volume), each of which was connected to an air pump that produced a one-way humidified air flow. at 150 ml / min (Pérez-Hedo et al. Journal or Pest Science 3: 543-554 (2015)).
    [0155] For each species, a female was introduced individually into the inlet tube of the olfactometer and observed until she had walked at least 3 cm through one of the arms of choice or until 15 minutes had elapsed. A total of 40 valid replicates were recorded for each species for each pair of odor sources. Each individual was tested only once. Females who did not choose a lateral arm within 15 minutes were recorded as "no response" and were excluded from the data analysis. After recording five responses, Tube Y was rinsed with soapy water and then cleaned with acetone and allowed to dry for 5 minutes. Odor sources were subsequently switched between the left and right side arms to minimize any spatial effect on the choice. The two types of plants (intact and induced) were used only once to assess the response of 10 females and were then replaced with new plants. The Y-tube experiment was performed under the following environmental conditions: 23 ± 2 ° C and 60 ± 10% RH.
    [0157] It was also studied if the defensive activation induced by exposure to propanoate of (Z) -3-hexenyl could influence the development of two important phytophages in tomato cultivation, the red spider, T. urtic ae and the lepidopteran T. absolute . The individuals used in these experiments came from the captive offspring of these species that are kept in the IVIA described above. The plant exposure time to the volatile was tested in both different ways on both phytophages, one where the The plant was only exposed to the volatile for 24 hours and then the herbivore to be tested was immediately released, and the other one where the volatile was permanently exposed throughout the entire experiment.
    [0159] For this, 2 climatic chambers were used under the same environmental conditions [25 ± 2 ° C, 65 ± 5% RH and 14:10 h (L: D) photoperiod], where, to avoid interferences between the volatiles, one was assigned to the (Z) -3-hexenyl propanoate treatments and another to the control treatment. 12 plastic cages (60 cm * 60 cm * 60 cm) were placed in the climatic chamber where the exposure to (Z) -3-hexenyl propanoate was tested (BugDorm-2. MegaView Science Co., Ltd., Taichung, Taiwan), six for each treatment tested (24 h exposure and permanent exposure), while six cages were placed in the climatic chamber where the control treatment was tested. The cages were equally distributed at a distance of one and a half meters between them. Each cage represented a replica. Two impregnated filter paper portions were placed in the bottom of each cage as explained above for both (Z) -3-hexenyl propanoate treatment and control. In the treatment where the volatiles were exposed throughout the experiment, the impregnated filter paper portions were replaced every other day.
    [0161] Eight tomato plants ( Lycopersicon esculentum cv. Moneymaker) were introduced into each cage . In the T. urticae experiment , to prevent movement of the mites from one plant to another, the plants were isolated individually, without touching each other or the cage walls. Additionally, the plants were placed on a small brick in a plastic tray filled with water, and all the pots were painted with a glue strip. Plants were artificially infested with T. urticae from the laboratory population mentioned above. Twenty females of T. urticae were released per plant, evenly distributed on all the leaves with the help of a fine brush. Bare eye sampling was performed seven, 14 and 21 days after the release of T. urticae, where the total number of T. urticae females in each plant was counted.
    [0163] To evaluate the effect of exposure to both volatiles on T. absolutes, two consecutive experiments were performed. In the first, the effect on the setting of absolute T. was studied. The selected eggs laid in the first experiment were subsequently used in the second to study the mortality of immature T.
    [0164] absolute developed in plants exposed to (Z) -3-hexenyl propanoate. The same three treatments described above for T. urticae were also tested for T. absolute. The setting of absolute T. was evaluated in 8 tomato plants (cv. Moneymaker) per treatment. Each of the plants was isolated inside a plastic cage (60 x 60 x 60 cm) (BugDorm-2) and kept in a climatic chamber at 25 ± 2 ° C, 65 ± 5% RH, 14:10 ( L: D) h photoperiod following the same assay distribution described for T. urticae. Within each cage (replica), 2 adult pairs of T. absolut (male and female) were released and left undisturbed for 72 hours. After this time, the adults of T. absolut were removed and the number of eggs was counted.
    [0166] To study the mortality of absolute T. in plants exposed to the 3 treatments described above, 6 eggs of absolute T. per plant were distributed equally in all the leaves with the help of a fine brush. The eggs used in each treatment came from the corresponding treatment of the first experiment. Mortality of absolute T. was evaluated in 8 tomato plants (cv. Moneymaker) per treatment. Each of the plants was isolated inside a plastic cage (60 x 60 x 60 cm) (BugDorm-2 insect tents) kept in a climatic chamber at 25 ± 2 ° C, 65 ± 5% RH, 14:10 (L: D) h photoperiod following the same treatment distribution described above. The plants were left intact until the adults of T. absolut emerged . As soon as the adults began to emerge, they were counted and removed daily from the cages.
    [0168] Outcome
    [0170] Exposure to the three volatiles (Z) -3-hexenyl propanoate, (Z) -3-hexenyl acetate and (Z) -3-hexenyl butanoate from intact tomato plants significantly overexpressed the three markers studied relative to control , without finding differences between them (Figure 1 A, B, C). PR-1: F 1-19 = 14.09; P <0.0001 SPI-1: F 1-19 = 21.91; P <0.0001 and SPI-2: F 1-19 = 16.28; P <0.0001.
    [0172] The activated plants exposed 24 hours to (Z) -3-hexenyl propanoate were found to be repellent against pests of great importance in the tomato such as the lepidopteran T. absolu (z2 = 9.80; P = 0.0017), the whitefly B. tabaci (z2 = 12.80; P = 0.0003) and thrips F. occidentalis ( x2 = 5.00; P = 0.0253) (Figure 1D). Furthermore, plants exposed to this volatile were more attractive to the parasitoid E. formosa ( j = 5.00; P = 0.0253). The red spider T. urticae was the only species that showed no preference = 1.80; P = 0.1797) (Figure 1D).
    [0174] In the case of the red spider, 21 days after its release, a reduction in the number of mites per plant was obtained of 50.3 ± 6.3% and 83.9 ± 5.0% compared to the control, in the treatments where the plant was kept exposed 24 h and throughout the experiment to (Z) -3-hexenyl propanoate, respectively (F 4.85 = 4.437; P = 0.003) (Figure 1E). In the case of absolute T., in the treatment of permanent exposure to (Z) -3-HP, a reduction in lay of 67.2 ± 15.0% was obtained with respect to the control (F 2.23 = 3.746; P = 0.0406) (Figure 1F). Furthermore, the mortality from egg to adult of absolute T. in plants permanently exposed to (Z) -3-HP was around 80%, which was significantly higher than the control treatment ( F 22.3 = 6.944; P = 0.0048 ) (Figure 1G). the setting ( F 223 = 1.147; P = 0.3367) nor in the mortality ( F 223 = 0.5881; P = 0.5643) of T. absolute.
    [0176] Example 2: Half-field release tests with different application rates of (Z) -3-hexenyl propionate from passive polymeric emitters.
    [0178] Methodology
    [0179] Two different types of polymeric emitters were used to check the activation level that different emission levels of (Z) -3-hexenyl propionate can provide: (LD) 4-ml low-density polyethylene vial and (HD) vial 4-ml high-density polyethylene. Through previous laboratory studies, the highest emission level (5 mg / day) was achieved with LD emitters loaded with 20 mg of the pure substance. The lowest emission level (0.01 mg / day) was provided by HD vials filled with a 1: 100 mixture of (Z) -3-hexenyl propionate and paraffinic oil (0.02: 2; g: g) . During the experiments, the emission kinetics of the emitters used were controlled by studying the weight loss (gravimetric method). Additional emitters were placed under the same environmental conditions, measuring their weight weekly with a precision balance (0.0001 g). The difference in weight recorded in each period will be the quantity of the substance emitted for each type of emitter. To obtain the mean emission level of each emitter, the recorded weights (y) are related to the aging time (x) by means of a multiple regression analysis.
    [0180] Once the mentioned emission levels, 5 and 0.01 mg / day / diffuser, were established, Tomato plants were exposed to different emission levels through an experiment in semi-field conditions, in a glass greenhouse. For this, there were three 24 m2 booths for the different treatments: (CONTROL) without volatile emitters, (HD) with 1 emitter of 0.01 mg / day, and (LD) with 1 emitter of 5 mg / day . The relative humidity was 65% ± 10% and the photoperiod was natural (approximately 14:10 h L: D) in the three cubicles. The environmental conditions were controlled and recorded using a Mithra climate data logger (ver. 1.01.03, Priva nutricontrol Ibérica SL). In each of the three cubicles, 30 tomato plants were transplanted into individual 20-liter polyethylene pots filled with a mixture of sand and peat (1: 2 w: w, respectively). The pots were distributed in each cabin in four rows of five plants each (2 plants / m2). The typical cultivation techniques of greenhouse tomato cultivation in Spain were followed: signed up to a guide for each plant, weekly pruning of secondary shoots, application of a standard nutritive solution for tomato using an automated irrigation system with an adjusted irrigation frequency. to environmental conditions and an irrigation time of 15 min. The diffusers were placed 50 cm above the apex of the tomato plants and were adapted in height according to the growth of the plants.
    [0182] The emitters were kept inside the corresponding booths throughout the test and samples were taken from the plants in each booth at 4 weeks after treatment installation. From these samples, the transcriptional response of the defensive PIN2 gene (a marker gene for the jasmonic acid signaling pathway, JA) was studied. Five repetitions per treatment were performed. For the extraction and quantification of gene expression, the methodology described by Pérez-Hedo et al. Journal of Pest Science 3: 543-554 (2015). The primer sequences used for the quantification of the PIN2 gene were direct ( forward): 5'-GAAAATCGTTAATTTATCCCAC-3 '(SEQ ID NO: 9) and reverse ( reverse): 5'-ACATACAAACTTTCCATCTTTA-3' (SEQ ID NO: 10 ), while the constitutive gene EF1 the sequences were forward: 5'-GATTGGTGGTATTGGAACTGTC-3 '(SEQ ID NO: 7) and reverse: 50-AGCTTCGTGGTGCATCTC-30 (SEQ ID NO: 8).
    [0184] Results
    [0185] Expression studies showed that the lowest level of (Z) -3-hexenyl propionate emission (0.01 mg / day) had no effect on exposed plants. However, an emission of 5 mg / day achieved significant activation of the route metabolic rate of jasmonic acid (Figure 2).
    [0187] Example 3. Trials of defensive activation in tomato via exposure under field conditions
    [0189] Methodology
    [0190] To know the behavior of the diffusers loaded with (Z) -3-hexenyl propionate under real growing conditions, four commercial cv Raf tomato greenhouses located in Xilxes (province of Castellón) with a history of absolute T. the coming of winter. A randomized block experimental design was carried out where each greenhouse was considered a block with two treatments per block and 4 repetitions per treatment. In these tomato greenhouses, the zoophytophage predator Nesidiocorís tenuis Reuter (Hemiptera: Miridae) has been used, which is released from the nursery in late August and keeps pest phytophagous populations under control after transplanting it in the greenhouse in late August until winter is coming. However, the populations of this predator drop sharply under the environmental conditions that occur in winter. At the end of winter, their populations begin to recover slowly, so that T. absolute populations do so faster and it is common to resort to selective insecticides during the spring to keep T. absolut at bay . Therefore, these greenhouses were considered an ideal setting to confirm the effect on T. absolute found under laboratory conditions.
    [0192] The cultivation began on September 4, 2018 with the transplant with a plantation frame of 0.4 x 1 m, which resulted in 1.2 plants per square meter (25,450 plants in 21,200 m2). The cultivation techniques common in the area were followed: the main stem was raised to two arms, secondary shoots and senescent leaves were pruned weekly and a standard nutrient solution was applied weekly to tomato using an automated drip irrigation system. The transplanted plants were inoculated in a seedbed with the predator N. tenuis. A dose of 1 N. tenuis per plant was released in the nursery and E. kuehniella eggs were used as alternative prey (Urbaneja-Bernat et al. Journal of Applied Entomology 139: 61-167 (2015)). From the date of planting to the day the diffusers were hung, none of the greenhouses received any chemical treatment, and pest control resided only with the predator N. tenuis.
    [0193] As mentioned above, 2 areas were selected in each of the greenhouses in which one of them on February 22, 2019 hung a 4-ml low-density polyethylene vial diffuser ((LD)) loaded with 4 ml of (Z) -3-hexenyl propanoate every 20 m2 and the other of equal surface was used as a control treatment. In the four volatile zones, a total of 260 diffusers were placed on a total area of 5,200 m2 (equivalent to a density of 500 diffusers / ha). As described in Example 2, the emission kinetics of the diffusers were studied using the gravimetric method.
    [0195] Twenty randomly selected plants per repeat were sampled weekly for 11 weeks, beginning on January 30, 2019. First, the number of leaflets infested by T. absolute per plant was counted. The number of N. tenuis (adults and nymphs) was then counted in the entire apical third of each plant plant (leaves, flowers and buds). Following the methodology described above, 6 samples were taken from the apical part of each plant by repetition, which were immediately introduced into liquid nitrogen to quantify the expression of the PR1 and PIN2 genes (described in Example 1 and Example 2). The expression of these genes was quantified one day before, 4 and 8 weeks after hanging the diffusers in the greenhouses.
    [0197] Outcome
    [0198] At the start of the assay, the expression of both defense pathway marker genes was the same, but at 30 and 60 days the expression of both genes was significantly higher in plants exposed to volatiles compared to plants in the control zone (Figure 3 A, B) (Table 1).
    [0200] Table 1 . Probability values for the pairwise comparison of the transcriptional response of the defensive genes PR1 (a marker gene for the SA signaling pathway) and PIN2 (a marker gene for the JA signaling pathway) in tomato plants exposed to (Z) -3-Hexenyl [(Z) -3-HP] released in a 4 ml low-density polyethylene vial (LD) polymer diffuser (Kartell) and in control tomato plants 24 hours before and 4 and 8 weeks after setting up the diffusers in tomato greenhouses. Values in bold correspond to statistically significant values. Test t (P <0.05).
    [0203] The myrid population, N. tenuis , remained the same in both treatments (Fi, 86 = 2,112; P = 0.150) (Figure 3C), but the infestation of T. absolute was not, which was significantly lower (approx. 58 %) in volatile treatment (F 1, 86 = 11.375, P <0.0001) (Figure 3D). Volatile (Z) -3-hexenyl volatile propanoate was emitted in a substantially constant way during the study period at an average rate of 12.2 mg / day, depending on the slope of the adjusted model (Figure 3E), which supposes a application rate of approximately 6 g / ha / day.
    [0205] Example 4. Trials of defensive activation in citrus via exposure under laboratory conditions
    [0206] To demonstrate that exposure to volatile (Z) -3-hexenyl propanoate activates defenses in citrus plants, seedlings of the Carrizo citrange pattern ( Citrus sinensis Osb. X Poncirus trifoliata L. Raf.) Were used. Two weeks after germination of the seeds, the seedlings were individually transplanted into pots (8 x 8 x 8 cm). The plants were kept in a plastic-covered greenhouse at climatic conditions of approximately 25 ± 5 ° C, a relative humidity of 65% ± 5%, and a photoperiod of natural light, approximately 14:10 h (light: dark). Carrizo citrange plants that had not received any pesticide treatment at 8 weeks of age (approximately 20 cm tall) were used. Volatile (Z) -3-hexenyl propanoate was obtained through Sigma-Aldrich (St. Louis, MO, USA). The volatile was exposed by using a 2 x 2 cm piece of filter paper on which 10 pl of a solution containing the volatile corresponding to a concentration of 1: 10,000 [(Z) -3- propanoate] was impregnated hexenyl: methanol] as the emission source for the corresponding volatile (Pérez-Hedo, M. et al. Biocontrol, 63: 203-213 (2018)).
    [0208] To activate a plant, two portions of filter paper impregnated with the volatile were placed at the bottom of a 30 x 30 x 30 cm plastic cage (BugDorm-1 Insect Tents; MegaView Science Co., Ltd, Taichung, Taiwan) in which the plant was introduced. A control treatment was performed in which the two portions of filter paper they were impregnated with 10,000 pl of methanol. Six repetitions per treatment were performed. The plants of both treatments were kept exposed to the volatile without disturbing for 24 hours in separate and isolated climatic chambers to avoid any interference from the volatile and were kept at 25 ± 2 ° C, 65 ± 10% RH and a photoperiod of 14:10 h (L: D). After 24 hours, the expression of 3 genes related to defensive activation in plants was studied in both treatments: a precursor of jasmonic acid JA (LOX2) and two related to the salicylic acid pathway, a downstream (PAL), and a precusor (NPR1).
    [0210] For the extraction and quantification of gene expression, the methodology described by Pérez-Hedo et al. Journal of Pest Science 3: 543-554 (2015). The primers used were direct (forward): 5'- GAACCATATTGCCACTTTCG -3 '(SEQ ID NO: 11) and inverse (reverse): 5'- CGTCATCAATGACTTGACCA -3' (SEQ ID NO: 12) for the quantification of LOX2, forward : 5'- CACATTCTTGGTAGCGCTTTG-3 '(SEQ ID NO: 13) and reverse: 5'- AGCTACTTGGCTGACAGTATTC-3' (SEQ ID NO: 14) for PAL and forward: 5'- TACCTCCACCTCTCTCATTCTT-3 '(SEQ ID NO: 15 ) and reverse: 5'-GTGCGAGAGAAGGTTAGCTATG-3 '(SEQ ID NO: 16) for the NPR5 gene. The nucleotides of the constitutive gene gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were forward: 5’-GGAAGGTCAAGATCGGAATCAA-3 ’(SEQ ID NO: 17) and reverse: 5’-CGTCCCTCTGCAAGATGACTCT-3’ (SEQ ID NO: 18).
    [0212] To assess the preference of females of D. citri and the parasitoid T. radiata to Carrizo citrange plants that were previously exposed for 24 h (Z) -3-HP in relation to intact plants, a Y-shaped olfactometer was used. same way as described in example 1 and the plants were exposed to both volatiles as described above with the use of the filter paper portions. A total of 40 valid replicates were recorded for each species for each pair of odor sources. Each individual was tested only once. Females who did not choose a lateral arm within 15 minutes were recorded as "no response" and were excluded from the data analysis. After recording five responses, Tube Y was rinsed with soapy water and then cleaned with acetone and allowed to dry for 5 minutes. Odor sources were subsequently switched between the left and right side arms to minimize any spatial effect on the choice. The two types of plants (intact and induced) were used only once to assess the response of 10 females and were then replaced with new plants. The Y-tube experiment was performed in the following environmental conditions: 25 ± 1 ° C and 60 ± 10% RH.
    [0214] The adults of D. citri were obtained from a colony established at SWFREC (University of Florida) whose original provenance was citrus located in their experimental plots. The parasitodes were collected in these experimental fields. Newly emerged adult females less than 5 days old were used in all trials.
    [0216] Outcome
    [0217] Exposure to volatile propanoate of (Z) -3-hexenyl to intact plants of Carrizo citrange significantly overexpressed the three markers studied (fig. 4A, B and C). Activated plants exposed 24 hours to (Z) -3-hexenyl propanoate were highly attractive to the parasitoid Tamarixia radiata ( j¿ = 6,914; P = 0.0043) and were indifferent to Diaphorina citri ( j = 1,429; P = 0.1160) (fig. 4D).
    [0219] Example 5. Response to defensive activation in citrus under field conditions
    [0221] Methodology
    [0222] Efficacy of using HP-charged diffusers in the field.
    [0224] A field of Valencia oranges with a high presence of receptive shoots and an adult population of D. citri located in the experimental fields of SWFREC (University of Florida) was selected. The field had an approximate extension of 0.3 ha. Sentinel plants were used that were hung inside the tree canopy. Sentinel plants were seedlings of Murraya paniculata with shoots receptive to D. citri lay . 7 seedlings were used with diffuser (polymeric diffuser that was loaded with 1.5 ml of (Z) -3-hexenyl propanoate and 7 seedlings without diffuser. Each seedling was distributed in the field following a random block design (using row of trees as a block) and in each block a seedling with a diffuser and another without was placed.The seedlings were located at a minimum distance of 50 meters between them to avoid any edge effect.
    [0226] After 4 days of placing the seedlings, these were collected from the field and taken to the laboratory where, under a binocular lens, the number of eggs per shoot was counted in each of the seedlings.
    [0227] Outcome
    [0228] No differences were found between the number of receptive outbreaks between both treatments. As previously observed in the laboratory and in the greenhouse, the placement of the diffusers of the volatile managed to reduce the D. citri spawn by more than 70% ( Figure 5 ).
    [0230] Although specific experiments carried out with tomato and citrus plants have been described, one skilled in the art will understand that the compound described in the present invention ((Z) -3-hexenyl propanoate) will be equally useful for use in protection. of other types of plants through the stimulation or induction of defense mechanisms. Also, although experiments have been described in which tomato plants have been subjected to certain pests, the person skilled in the art will understand that the compound described in the present invention will be equally useful for use in protecting plants against other pests.
    权利要求:
    Claims (17)
    [1]
    1. Use of at least one compound of formula I

    [2]
    2. Use according to claim 1, where the compound of formula I is (Z) -3-hexenyl propanoate.
    [3]
    3. Use according to claim 1 or 2, where the protection of the plants is produced by repelling pests and / or attracting parasitoids from pests.
    [4]
    4. Use according to any one of claims 1 to 3, wherein the defense mechanisms of the plants cause the repellency of the pests that are selected from the list that includes: the white flies Bemisia tabaci (Gennadius) and Tríaleurodes vaporariorum ( Westwood), Aleurothrixus floccosus (Maskell), Dialeurodes citri (Ashmead), and Paraleyrodes minei Iaccarino (Hemiptera: Aleyroididae), thrips Frankliniella occidentalis Pergande, Pezothrips kellyanus Bagnall, Chaetanaphothrips orchidii (Moulton), and Thrips tabaan Thrips: Thrips Tabaan Thrips (Orchidii), Thrips Thrips, Thrips, Thrips, Thrips, Thrips, Thrips, Thrips, Thrips, Thrips, Thrips, Thrips, Thrips and Thrips red spiders Tetranychus urticae, Eutetranychus orientalis (Klein), Eutetranychus banksi (McGregor), T. urticae, Panonychus citri (McGregor) and Tetranychus evansi Koch Baker & Pritchard (Acari: Tetranychidae), lepidopteran Tuta absoluta (Meyrick), Phyllocnistis citrella Stainton (Lepidoptera: Gracillariidae), Spodoptera exigua Hübner and Helicoverpa armígera (Hübner) (Lepidoptera: Noctuidae) and the Diaphori psyllids na citri Kuwayama (Hemiptera: Liviidae) and Trioza erytreae (Del Guercio) (Hemiptera: Psyllidae).
    [5]
    5. Use according to claim any of claims 1 to 4 wherein the Plant defense mechanisms provoke the attraction of the parasitoids selected from the list that includes species of the genera: Encarsia spp., Aphytis spp. Cales spp., Eretmocerus spp., Aphelinus spp., (Hymenoptera: Aphelinidae), Aphidius spp. Lysiphlebus spp. (Hymenoptera: Braconidae) Metaphycus spp., Anagyrus spp. (Hymenoptera: Encyrtidae), Tamarixia spp. Citrostichus spp., Cirrospilus spp., Diglyphus spp. (Hymenoptera: Eulophidae), Trissolcus spp., Telenomus spp. (Hymenoptera: Scelionidae) and Trichogramma spp. (Hymenoptera. T richogrammatidae).
    [6]
    6. Use according to any of claims 1 to 5, where the protected plants are horticultural or citrus plants.
    [7]
    7. Use according to any of claims 1 to 6, where at least one compound of formula I, or of a composition comprising it, is applied to plants by means of diffusers.
    [8]
    8. Method for the protection of plants against pests by stimulating the natural defense mechanisms of said plants, characterized in that it involves contacting at least one compound of formula I, or a composition comprising them, with the plants:

    [9]
    9. Method according to claim 8, characterized in that the compound of formula I is (Z) -3-hexenyl propanoate.
    [10]
    10. Method according to claim 8 or 9, characterized in that the compound of formula I, or of a composition comprising it, is contacted with the plant by means of diffusers.
    [11]
    11. Method, according to claim 10, characterized in that the diffuser is a passive emitter consisting of a container of the compound of formula I configured to allow the diffusion of said compound to the environment surrounding the plant.
    [12]
    12. Method according to claim 10, characterized in that the diffuser consists of a nebulizer that produces an aerosol.
    [13]
    13. Method, according to claim 10, characterized in that the diffuser is a liquid or gel composition that contains the compound of formula I and that is formulated to allow the diffusion of said compound to the environment.
    [14]
    14. Method according to any of claims 10 to 13, characterized in that the dose of compound applied to the environment surrounding the plants by the diffuser is between 25 mg / ha / day and 25 g / ha / day.
    [15]
    15. Method according to any of the previous claims 8 to 14, characterized in that the natural defense mechanisms stimulated in the plants cause the repellency of pests selected from the list that includes: the white flies Bemisia tabaci (Gennadius) and Tríaleurodes vaporariorum (Westwood ), Aleurothrixus floccosus (Maskell), Dialeurodes citri (Ashmead) and Paraleyrodes minei Iaccarino (Hemiptera: Aleyroididae), thrips Frankliniella occidentalis Pergande, Pezothrips kellyanus Bagnall, Chaetanaphothrips orchidii (Moulton), and Thrips tabacian ( Lindebade ) Thrips tabacius red Tetranychus urticae, Eutetranychus orientalis (Klein), Eutetranychus banksi (McGregor), T. urticae, Panonychus citri (McGregor) and Tetranychus evansi Koch Baker & Pritchard (Acari: Tetranychidae), lepidopteran Tuta absoluta (Meyrick), Phyllocnistis citrella Stainton ( Lepidoptera: Gracillariidae), Spodoptera exigua Hübner and Helicoverpa armígera (Hübner) (Lepidoptera: Noctuida and); and the psyllids Diaphorina citri Kuwayama (Hemiptera: Liviidae) and Trioza erytreae (Del Guercio) (Hemiptera: Psyllidae).
    [16]
    16. Method according to any of claims 8 to 15, characterized in that the natural defense mechanisms stimulated in the plants cause the attraction of parasitoids selected from the list that includes species of the genera: Encarsia spp., Aphytis spp. Cales spp., Eretmocerus spp., Aphelinus spp., (Hymenoptera: Aphelinidae), Aphidius spp. Lysiphlebus spp. (Hymenoptera: Braconidae) Metaphycus spp., Anagyrus spp. (Hymenoptera: Encyrtidae), Tamaríxia spp. Citrostichus spp., Cirrospilus spp., Diglyphus spp. (Hymenoptera: Eulophidae), Trissolcus spp., Telenomus spp. (Hymenoptera: Scelionidae) and Trichogramma spp. (Hymenoptera. T richogrammatidae).
    [17]
    17. Method according to any of claims 8 to 16, characterized in that the plant is a horticultural plant or a citrus.
    类似技术:
    公开号 | 公开日 | 专利标题
    Giblin-Davis et al.2013|Biology and management of the red palm weevil, Rhynchophorus ferrugineus
    Hamilton et al.2018|Halyomorpha halys |
    JP6467177B2|2019-02-06|Natural enemy insect attractant component derived from floral scent and its use
    Tremblay et al.2001|Effects of bird predation on some pest insect populations in corn
    Smart et al.2014|Role of semiochemicals in integrated pest management
    Kong et al.2014|Sex-pheromone-mediated mating disruption technology for the oriental fruit moth, Grapholita molesta |: overview and prospects
    Sanda et al.2018|Biological invasion of tomato leaf miner, Tuta absoluta | in Nigeria: problems and management strategies optimization: a review
    Raja et al.2015|Efficacy of the entomopathogenic nematode Heterorhabditis bacteriophora using different application methods in the presence or absence of a natural enemy
    Leon et al.2016|Seed production and control of sicklepod | and pitted morningglory | with 2, 4-D, dicamba, and glyphosate combinations
    Benítez-Malvido et al.2003|Germination and seed damage in tropical dry forest plants ingested by iguanas
    ES2351449A1|2011-02-04|Process for rearing a species of indigenous parasitoid and use thereof for controlling lepidopteran crop pest
    ES2763224B2|2021-02-23|Use of | -3-hexenyl esters and method to protect plants against pests
    Sampson2014|Management of the western flower thrips on strawberry
    Kuchment2013|The end of orange juice
    KR100421779B1|2004-03-10|Korean entomopathogenic nematode, steinernema carpocapsae gsn 1 and control method for insect
    Zaini et al.2013|Effect of nutrient and pre-infested brinjal, Solanum melongena by whitefly and aphid on population dynamics of whitefly, Bemisia tabaci
    Marsh2017|Use of Curry Leaf | and Volkamer Lemon | as Potential Trap Crops for the Asian Citrus Psyllid | in a Commercial Citrus Grove
    O'Donnell2015|The relationship between the winter moth | and its host plants in Coastal Maine
    Huiting et al.2006|Biology, control and luring of the cockchafer, Melolontha melolontha: literature report on biology, life cycle and pest incidence, current control possibilities and pheromones
    Hartfield et al.2003|Releasing the rove beetle Aleochara bilineata in the field as a biological agent for controlling the immature stages of the cabbage root fly, Delia radicum
    Kwon et al.2006|An Evidence to Use Cotes/a plutellae | as a Field Control Agent against Diamondback Moth, Plutella xylostella L |
    Altilmisani2016|Wheat stem sawfly oviposition preference and survivorship on winter wheat and downy brome
    Sharon et al.2010|Intraspecific attraction and host tree selection by adult Capnodis tenebrionis
    Otieno2016|Integration of soil-applied azadirachtin with predators, entomopathogens and optical/chemical traps for the management of western flower thrips, Frankliniella occidentalis Pergande |
    박영균2020|Eco-friendly pest management strategy for Frankliniella occidentalis and Bemisia tabaci in tomato smart greenhouse of Korea
    同族专利:
    公开号 | 公开日
    ES2763224B2|2021-02-23|
    WO2021214360A1|2021-10-28|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    CN106614583A|2016-12-12|2017-05-10|江苏省农业科学院|Plant-derived attractant and application thereof|
    CN110074143A|2019-05-08|2019-08-02|金华市农业科学研究院|A kind of composition and preparation method thereof for luring tea seed weevil adult|
    法律状态:
    2020-05-27| BA2A| Patent application published|Ref document number: 2763224 Country of ref document: ES Kind code of ref document: A1 Effective date: 20200527 |
    2021-02-23| FG2A| Definitive protection|Ref document number: 2763224 Country of ref document: ES Kind code of ref document: B2 Effective date: 20210223 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES202030330A|ES2763224B2|2020-04-21|2020-04-21|Use of-3-hexenyl esters and method to protect plants against pests|ES202030330A| ES2763224B2|2020-04-21|2020-04-21|Use of-3-hexenyl esters and method to protect plants against pests|
    PCT/ES2021/070259| WO2021214360A1|2020-04-21|2021-04-20|Use of -3-hexenyl esters and method for protecting plants against pests|
    [返回顶部]